| Internal ID | 17657588 | Source Database | TransTermHP TERM 1569 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1569
|
| Sequence |
GGCCCCGACACACTCCGGGCC Look for more occurrences |
| Start | 6497737 |
| End | 6497757 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGCCTCGTGCTCAT(5' tail) GGCCCCGA(5' stem) CACAC(loop) TCCGGGCC(3' stem) TTTTTATCCACAGGA(3' tail). Confidence: 90. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|