Internal ID | 17658853 | Source Database | TransTermHP TERM 658 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 658
|
Sequence |
GGCCGCATCCTCAGGCAGGTGCGGCC Look for more occurrences |
Start | 2743728 |
End | 2743753 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas syringae pv. tomato str. DC3000 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCTTCAACCGTTTTG(5' tail) GGCCGCATCCT(5' stem) CAGGC(loop) AGG-TGCGGCC(3' stem) TTTTTTTGGGTGTTT(3' tail). Confidence: 100. gap 1 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|