Internal ID | 17660374 | Source Database | TransTermHP TERM 106 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 106
|
Sequence |
GGACGCGGTGTATGCCGCGTCC Look for more occurrences |
Start | 508836 |
End | 508857 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas syringae pv. phaseolicola 1448A chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TAGCTGAGCGAAAGA(5' tail) GGACGCGGT(5' stem) GTAT(loop) GCCGCGTCC(3' stem) TTTTTTTATGCGCGC(3' tail). Confidence: 100. opp_overlap 508834 508836 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|