| Internal ID | 17660916 | Source Database | TransTermHP TERM 957 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 957
|
| Sequence |
GCCCGCAACCAGTAATGGTTGCGGGC Look for more occurrences |
| Start | 4238312 |
| End | 4238337 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. phaseolicola 1448A chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCAGACTGAAAAAA(5' tail) GCCCGCAACCA(5' stem) GTAA(loop) TGGTTGCGGGC(3' stem) TTTTTATTGCGTGCC(3' tail). Confidence: 100. opp_overlap 4238312 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|