| Internal ID | 17661170 | Source Database | TransTermHP TERM 1345 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1345
|
| Sequence |
GCCCCGGCTCGCTTGGCGACCGGGGC Look for more occurrences |
| Start | 5789046 |
| End | 5789071 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. phaseolicola 1448A chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCCTGCCACATTAAA(5' tail) GCCCCGGCTCGC(5' stem) TTG(loop) GCGA-CCGGGGC(3' stem) TTTTTACATTCTGCG(3' tail). Confidence: 100. gap 1, opp_overlap 5789046 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|