Internal ID | 17662341 | Source Database | TransTermHP TERM 13 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 13
|
Sequence |
GGCGCAGCGGAGGTAGCCGCTGCGCC Look for more occurrences |
Start | 14678 |
End | 14703 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCAGACTGATGAAGA(5' tail) GGCGCAGCGG(5' stem) AGGTAG(loop) CCGCTGCGCC(3' stem) TTTTTTCGTTCAGGG(3' tail). Confidence: 100. opp_overlap 14676 14678 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|