| Internal ID | 17663273 | Source Database | TransTermHP TERM 1521 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1521
|
| Sequence |
CCCCCGCTCCCGCCAGGGACCGGGGG Look for more occurrences |
| Start | 6545349 |
| End | 6545374 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGGGCATGAAAAA(5' tail) CCCCCGGTCCC(5' stem) TGGC(loop) GGGAGCGGGGG(3' stem) TTTGCGCGGCCCCGA(3' tail). Confidence: 100. opp_overlap 6545349 6545368, overlap 6545316 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|