Internal ID | 17666595 | Source Database | TransTermHP TERM 1361 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1361
|
Sequence |
AGACCTGCATGTGCAGGTCA Look for more occurrences |
Start | 4397928 |
End | 4397947 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fluorescens Pf0-1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ACCGGCCATAAAAAA(5' tail) TGACCTGC(5' stem) ACAT(loop) GCAGGTCT(3' stem) TTTTTTTGCCTTCCG(3' tail). Confidence: 100. opp_overlap 4397929, overlap 4397929 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|