Internal ID | 17666829 | Source Database | TransTermHP TERM 1653 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1653
|
Sequence |
GGCCAGCCTGATGCGCTGGCC Look for more occurrences |
Start | 5266644 |
End | 5266664 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas fluorescens Pf0-1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGCTACAGTAAAAA(5' tail) GGCCAGC(5' stem) CTGATGC(loop) GCTGGCC(3' stem) TTTTTCTTGCCTGCG(3' tail). Confidence: 100. opp_overlap 5266644, overlap 5266638 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|