| Internal ID | 17668820 | Source Database | TransTermHP TERM 1474 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1474
|
| Sequence |
GGCCCGAGCCTATGCTTCGGGCC Look for more occurrences |
| Start | 6015542 |
| End | 6015564 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida GB-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCTCAACCTTTCAA(5' tail) GGCCCG-AGC(5' stem) CTAT(loop) GCTTCGGGCC(3' stem) TTTTTTTTGCCTGAT(3' tail). Confidence: 100. gap 1, overlap 6015540 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|