| Internal ID | 17669158 | Source Database | TransTermHP TERM 454 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 454
|
| Sequence |
GACAGGCCAATCGAGATTGGCTGTC Look for more occurrences |
| Start | 1725739 |
| End | 1725763 |
| Strand | + |
| Genomic Context | Located within gene [PSEBR_m483] |
| Replicon | Pseudomonas brassicacearum subsp. brassicacearum NFM421 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGGCATGGAGATTGA(5' tail) GACAGGCCAAT(5' stem) CGAG(loop) ATTGGC-TGTC(3' stem) TTTTTAATTGTGGCC(3' tail). Confidence: 95. gap 1, opp_overlap 1725743 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|