Internal ID | 17669899 | Source Database | TransTermHP TERM 7 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 7
|
Sequence |
CGGCGCCTCGCAATGAGGCGCCG Look for more occurrences |
Start | 22241 |
End | 22263 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas fulva 12-X chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TGGTACTGAAATTTG(5' tail) CGGCGCCTCG(5' stem) CAA(loop) TGAGGCGCCG(3' stem) TTTCGCTGGGCTTGT(3' tail). Confidence: 100. opp_overlap 22238 22237 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|