Internal ID | 17669920 | Source Database | TransTermHP TERM 38 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 38
|
Sequence |
CCGCTGCTCCGGTTACGGGCAGCGG Look for more occurrences |
Start | 166539 |
End | 166563 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fulva 12-X chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCGGCAATAAAAAA(5' tail) CCGCTGC-CCG(5' stem) TAAC(loop) CGGAGCAGCGG(3' stem) TTTTTTTATGCGCGA(3' tail). Confidence: 100. gap 1, opp_overlap 166524 166539 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|