| Internal ID | 17672535 | Source Database | TransTermHP TERM 956 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 956
|
| Sequence |
CGCCCCGCACCGACGGGGCG Look for more occurrences |
| Start | 5023382 |
| End | 5023401 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens F113 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AAGCGGAAAAGAAAA(5' tail) CGCCCCG(5' stem) TCGGTG(loop) CGGGGCG(3' stem) TTTATTGGGTCTGTT(3' tail). Confidence: 100. opp_overlap 5023382 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|