| Internal ID | 17672811 | Source Database | TransTermHP TERM 1322 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1322
|
| Sequence |
GCGCGGCGTGTCAGCCGCGC Look for more occurrences |
| Start | 6375981 |
| End | 6376000 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens F113 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TACAGACAAAAAAAA(5' tail) GCGCGGC(5' stem) TGACAC(loop) GCCGCGC(3' stem) TTTTTTCTGTCATGA(3' tail). Confidence: 100. opp_overlap 6375981 6375961, overlap 6375972 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|