| Internal ID | 17673952 | Source Database | TransTermHP TERM 132 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 132
|
| Sequence |
GAAAACCCCGCTTCGGCGGGGTTTTC Look for more occurrences |
| Start | 434899 |
| End | 434924 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida S16 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGGGAAACAGTCTG(5' tail) GAAAACCCCGC(5' stem) TTCG(loop) GCGGGGTTTTC(3' stem) TTTGTGCGCGTGTTT(3' tail). Confidence: 100. opp_overlap 434904, overlap 434904 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|