| Internal ID | 17676639 | Source Database | TransTermHP TERM 92 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 92
|
| Sequence |
CCTCGGCCTGGGCGCAGGCCGAGG Look for more occurrences |
| Start | 432961 |
| End | 432984 |
| Strand | + |
| Genomic Context | Located within gene [PADK2_02000] |
| Replicon | Pseudomonas aeruginosa DK2 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGTAGGCCAGCGGCT(5' tail) CCTCGGCCTG(5' stem) GGCG(loop) CAGGCCGAGG(3' stem) TTTCCAGTTGCAGGG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|