Internal ID | 17682786 | Source Database | TransTermHP TERM 4 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 4
|
Sequence |
GAAGCCCCGCTATGGCGGGGCTTC Look for more occurrences |
Start | 6945 |
End | 6968 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa B136-33, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTCGCGTGAAAACAA(5' tail) GAAGCCCCGC(5' stem) TATG(loop) GCGGGGCTTC(3' stem) TTTTATCGAATCGGC(3' tail). Confidence: 100. opp_overlap 6945 6948 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|