Internal ID | 17683794 | Source Database | TransTermHP TERM 47 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 47
|
Sequence |
GAGGCTTCACGGAAACGGAAGCCTC Look for more occurrences |
Start | 296414 |
End | 296438 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa RP73, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGGGCCTTTCTTTCA(5' tail) GAGGCTTCACG(5' stem) GAAA(loop) CG-GAAGCCTC(3' stem) TTTTTTCTGCCAGGG(3' tail). Confidence: 100. gap 1 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|