| Internal ID | 17683889 | Source Database | TransTermHP TERM 191 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 191
|
| Sequence |
AGGGCCTCGTCCGAGGCCCC Look for more occurrences |
| Start | 831080 |
| End | 831099 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa RP73, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCGGAAAAGAAAA(5' tail) GGGGCCTC(5' stem) GGAC(loop) GAGGCCCT(3' stem) TTTTTCGTTGCGCCG(3' tail). Confidence: 100. opp_overlap 831081, overlap 831075 831081 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|