Internal ID | 17685880 | Source Database | TransTermHP TERM 636 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 636
|
Sequence |
CCCCATGATCGCTCATGGGG Look for more occurrences |
Start | 2823994 |
End | 2824013 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCTGAAAACACAAAA(5' tail) CCCCATGA(5' stem) GCGA(loop) TCATGGGG(3' stem) TTTTTTGTGTCTTGC(3' tail). Confidence: 100. opp_overlap 2823994 2823987, overlap 2823987 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|