Internal ID | 17688529 | Source Database | TransTermHP TERM 83 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 83
|
Sequence |
CGCCGCTCCCCGCAAGGGCAGCGGCG Look for more occurrences |
Start | 278887 |
End | 278912 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCCGGGCATGAAAAA(5' tail) CGCCGCTGCCC(5' stem) TTGC(loop) GGGGAGCGGCG(3' stem) TTTCTCAGGGTGGCG(3' tail). Confidence: 100. opp_overlap 278887 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|