| Internal ID | 17688530 | Source Database | TransTermHP TERM 84 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 84
|
| Sequence |
CGCCGCTGCCCTTGCGGGGAGCGGCG Look for more occurrences |
| Start | 278887 |
| End | 278912 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCCGGGCATGAAAAA(5' tail) CGCCGCTGCCC(5' stem) TTGC(loop) GGGGAGCGGCG(3' stem) TTTCTCAGGGTGGCG(3' tail). Confidence: 95. opp_overlap 278887 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|