| Internal ID | 17689070 | Source Database | TransTermHP TERM 887 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 887
|
| Sequence |
CGAATGCCCTCTTCGGAGGGCATTCG Look for more occurrences |
| Start | 2908055 |
| End | 2908080 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCAATCGCAGAAACA(5' tail) CGAATGCCCTC(5' stem) CGAA(loop) GAGGGCATTCG(3' stem) TTCGCGACGGCTGGA(3' tail). Confidence: 100. opp_overlap 2908059, overlap 2908053 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|