Internal ID | 935695 | Source Database | PRODORIC SI001011 |
Feature Type | site |
Name |
LasR binding site
|
Sequence |
AACCTGCCAGAACTGGCAGG Look for more occurrences |
Start | 4170656 |
End | 4170675 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
|
Additional Comments |
Co-dependent positive regulation of the ansB promoter of Escherichia coli by CRP and the FNR protein: a molecular analysis.
Jennings MP, Beacham IR
Mol. Microbiol. 1993 Jul;9(1):155-64
PubMed ID: 8412660
|