| Internal ID | 935696 | Source Database | PRODORIC SI001010 |
| Feature Type | site |
| Name |
LasR binding site (OP2)
|
| Sequence |
ATAGCTAGCAGAAAAGCAGG Look for more occurrences |
| Start | 4170716 |
| End | 4170735 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
|
| Additional Comments |
|
Co-dependent positive regulation of the ansB promoter of Escherichia coli by CRP and the FNR protein: a molecular analysis.
Jennings MP, Beacham IR
Mol. Microbiol. 1993 Jul;9(1):155-64
PubMed ID: 8412660
|